Changes between Initial Version and Version 1 of blastTips


Ignore:
Timestamp:
03/11/20 12:59:18 (7 years ago)
Author:
dionisio
Comment:

--

Legend:

Unmodified
Added
Removed
Modified
  • blastTips

    v1 v1  
     1=== BLAST+ Quick Start Guide ===
     2
     3For more complete information, visit NCBI:
     4  * [[http://www.ncbi.nlm.nih.gov/books/NBK1763/|BLAST Command Line Applications User Manual]]
     5  * [[http://www.ncbi.nlm.nih.gov/books/NBK279675/ | BLAST+ Command-line options]]
     6  * [[http://iona.wi.mit.edu/bio/databases/list.php | Local Blast Databases]]
     7  * [[http://www.biomedcentral.com/1471-2105/10/421|BLAST+: architecture and applications]] - BMC Bioinformatics 2009, 10:421
     8
     9**Examples are all for BLASTN but should work similarly for other BLAST+ commands (blastp, blastx, tblastn, and tblastx). **
     10
     11
     12**Note that on tak, 'blastn' is an alias for 'bsub blastn' (and other BLAST+ commands have corresponding aliases), so don't include 'bsub' as part of your command.**
     13
     14
     15=== Tasks ===
     16||'''Task''' || '''Description''' ||
     17||blastp        || Traditional BLASTP to compare a protein query to a protein database ||
     18||blastp-short || BLASTP optimized for queries shorter than 30 residues ||
     19||blastn || Traditional BLASTN requiring an exact match of 11 ||
     20||blastn-short || BLASTN program optimized for sequences shorter than 50 bases ||
     21||megablast || Traditional megablast used to find very similar (e.g., intraspecies or closely related species) sequences ||
     22||dc-megablast ||       Discontiguous megablast used to find more distant (e.g., interspecies) sequences ||
     23
     24
     25=== Index or Make BLAST database ===
     26* Index a file of fasta sequences to create a custom blastn database, such as
     27
     28{{{
     29>Sequence1
     30CTGTGACTTGAATGCAAATATCACCAAGAAGTTTGTGAGA
     31>Sequence2
     32TGGGAGGGGCTTGGCGGGGAGTCCGTTGTTGAAGGATGGT
     33...
     34}}}
     35     
     36
     37
     38{{{
     39makeblastdb -dbtype nucl -parse_seqids -in myBlastDatabase.fa
     40}}}
     41
     42
     43Note that '–parse_seqids' is needed to be able to later extract sequences by their IDs, but using it drastically slows down indexing.  For '-dbtype', choose '''nucl''' or '''prot'''.
     44
     45  * Specify a title for the database as well as an output file name
     46
     47{{{
     48makeblastdb -in mature_mirna -title "micrornas $today" -parse_seqids -dbtype nucl -out mature_mirna
     49}}}
     50
     51In the blast version 2.8 and later, you could also search for target sequences belong to certain species. The database should be in version 5 format. To create the databases, you need to specify '-parse_seqids -blastdb_version 5' and assign sequences to taxonomy ID with -taxid or -taxid_map, such as -taxid 9606 to assign all sequences to human. With '-taxid_map', you could assign a species to each sequence.  It requires a text file with format: <SequenceId> <TaxonomyId><newline>
     52
     53
     54=== Run BLAST command ===
     55
     56  * Run a basic (but sensitive) blastn search.  The default blastn command runs megablastn with a default word size of 28, whereas '-task blastn' uses a default word size of 11.
     57
     58{{{
     59
     60
     61blastn -task blastn -query Query_seqs.fa -db myBlastDatabase.fa -evalue 0.05 -out Query_seqs.blastn.txt
     62}}}
     63
     64  * Run the blastn program optimized for sequences shorter than 50 bases (default word size of 7)
     65
     66{{{
     67blastn -task blastn-short -query oligos.fa -db mature_mirna -out Query_seqs.blastn-short.txt
     68}}}
     69
     70  * Restrict search of database to include only the specified taxonomy IDs
     71{{{
     72# limit to human targets:
     73blastn -query oligos.fa -db nt -taxids 9606 -out Query_seqs_to_human.txt
     74
     75# blast to all species under plant:
     76blastn -query oligos.fa -db nt -taxidlist plant_speciesTaxids.txt -out Query_seqs_to_plants.txt
     77# where plant_speciesTaxids.txt includes species taxonomy ids for all plants, which can be created with
     78get_species_taxids.sh  -t 3193 > plant_speciesTaxids.txt
     79# where 3193 refers to plant
     80}}}
     81
     82  * Extract all sequence(s) from a blast database (in case you've deleted the original fasta file)
     83
     84{{{
     85blastdbcmd -db myBlastDatabase.fa -entry all > myBlastDatabase.fa
     86}}}
     87
     88Note that the output format for custom databases may be not quite fasta:
     89
     90 
     91{{{
     92>lcl|Sequence0CTGTGACTTGAATGCAAATATCACCAAGAAGTTTGTGAGA
     93>lcl|Sequence1TGGGAGGGGCTTGGCGGGGAGTCCGTTGTTGAAGGATGGT
     94...
     95}}}
     96
     97
     98  * Extract one desired sequence ID from a blast database
     99
     100{{{
     101blastdbcmd -db myBlastDatabase.fa -entry Sequence2 > Sequence2.fa
     102}}}
     103
     104  * Extract a list of desired sequence IDs from a blast database
     105
     106{{{
     107blastdbcmd -db myBlastDatabase.fa -entry_batch IDs_to_get.txt > IDs_to_get.fa
     108}}}
     109
     110where the format of IDs_to_get.txt (IDs of sequences you want to extract) is simply one ID per line, such as
     111
     112 
     113{{{
     114Sequence2
     115Sequence3
     116Sequence4
     117}}}
     118
     119and the output file is standard fasta.
     120
     121  * Get all command-line arguments
     122
     123{{{
     124blastn -help
     125}}}
     126
     127  * Note that databases indexed for old-style blastall (using formatdb) work fine with blast+.
     128
     129=== Filtering BLAST results===
     130  * Limiting or filtering hits: do not use max_target_seqs.  Based on [[https://academic.oup.com/bioinformatics/advance-article/doi/10.1093/bioinformatics/bty833/5106166 | Misunderstood parameter of NCBI BLAST impacts the correctness of bioinformatics workflows]], this parameter does not return the top/best hit(s)!  Instead, get all hits and filter downstream as needed.
     131