Changes between Initial Version and Version 1 of blastTips

Timestamp:

03/11/20 12:59:18 (5 years ago)

Author:

dionisio

Comment:

--

blastTips

@@ +1 @@
+=== BLAST+ Quick Start Guide ===
+
+For more complete information, visit NCBI:
+  * [[http://www.ncbi.nlm.nih.gov/books/NBK1763/|BLAST Command Line Applications User Manual]]
+  * [[http://www.ncbi.nlm.nih.gov/books/NBK279675/ | BLAST+ Command-line options]]
+  * [[http://iona.wi.mit.edu/bio/databases/list.php | Local Blast Databases]]
+  * [[http://www.biomedcentral.com/1471-2105/10/421|BLAST+: architecture and applications]] - BMC Bioinformatics 2009, 10:421
+
+**Examples are all for BLASTN but should work similarly for other BLAST+ commands (blastp, blastx, tblastn, and tblastx). **
+
+
+**Note that on tak, 'blastn' is an alias for 'bsub blastn' (and other BLAST+ commands have corresponding aliases), so don't include 'bsub' as part of your command.**
+
+
+=== Tasks ===
+||'''Task''' || '''Description''' ||
+||blastp        || Traditional BLASTP to compare a protein query to a protein database ||
+||blastp-short || BLASTP optimized for queries shorter than 30 residues ||
+||blastn || Traditional BLASTN requiring an exact match of 11 ||
+||blastn-short || BLASTN program optimized for sequences shorter than 50 bases ||
+||megablast || Traditional megablast used to find very similar (e.g., intraspecies or closely related species) sequences ||
+||dc-megablast ||       Discontiguous megablast used to find more distant (e.g., interspecies) sequences ||
+
+
+=== Index or Make BLAST database ===
+* Index a file of fasta sequences to create a custom blastn database, such as
+
+{{{
+>Sequence1
+CTGTGACTTGAATGCAAATATCACCAAGAAGTTTGTGAGA
+>Sequence2
+TGGGAGGGGCTTGGCGGGGAGTCCGTTGTTGAAGGATGGT
+...
+}}}
+     
+
+
+{{{
+makeblastdb -dbtype nucl -parse_seqids -in myBlastDatabase.fa
+}}}
+
+
+Note that '–parse_seqids' is needed to be able to later extract sequences by their IDs, but using it drastically slows down indexing.  For '-dbtype', choose '''nucl''' or '''prot'''.
+
+  * Specify a title for the database as well as an output file name
+
+{{{
+makeblastdb -in mature_mirna -title "micrornas $today" -parse_seqids -dbtype nucl -out mature_mirna
+}}}
+
+In the blast version 2.8 and later, you could also search for target sequences belong to certain species. The database should be in version 5 format. To create the databases, you need to specify '-parse_seqids -blastdb_version 5' and assign sequences to taxonomy ID with -taxid or -taxid_map, such as -taxid 9606 to assign all sequences to human. With '-taxid_map', you could assign a species to each sequence.  It requires a text file with format: <SequenceId> <TaxonomyId><newline>
+
+
+=== Run BLAST command ===
+
+  * Run a basic (but sensitive) blastn search.  The default blastn command runs megablastn with a default word size of 28, whereas '-task blastn' uses a default word size of 11.
+
+{{{
+
+
+blastn -task blastn -query Query_seqs.fa -db myBlastDatabase.fa -evalue 0.05 -out Query_seqs.blastn.txt
+}}}
+
+  * Run the blastn program optimized for sequences shorter than 50 bases (default word size of 7) 
+
+{{{
+blastn -task blastn-short -query oligos.fa -db mature_mirna -out Query_seqs.blastn-short.txt
+}}}
+
+  * Restrict search of database to include only the specified taxonomy IDs
+{{{
+# limit to human targets:
+blastn -query oligos.fa -db nt -taxids 9606 -out Query_seqs_to_human.txt
+
+# blast to all species under plant:
+blastn -query oligos.fa -db nt -taxidlist plant_speciesTaxids.txt -out Query_seqs_to_plants.txt
+# where plant_speciesTaxids.txt includes species taxonomy ids for all plants, which can be created with 
+get_species_taxids.sh  -t 3193 > plant_speciesTaxids.txt
+# where 3193 refers to plant
+}}}
+
+  * Extract all sequence(s) from a blast database (in case you've deleted the original fasta file)
+
+{{{
+blastdbcmd -db myBlastDatabase.fa -entry all > myBlastDatabase.fa
+}}}
+
+Note that the output format for custom databases may be not quite fasta:
+
+ 
+{{{
+>lcl|Sequence0CTGTGACTTGAATGCAAATATCACCAAGAAGTTTGTGAGA
+>lcl|Sequence1TGGGAGGGGCTTGGCGGGGAGTCCGTTGTTGAAGGATGGT
+...
+}}}
+
+
+  * Extract one desired sequence ID from a blast database
+
+{{{
+blastdbcmd -db myBlastDatabase.fa -entry Sequence2 > Sequence2.fa
+}}}
+
+  * Extract a list of desired sequence IDs from a blast database
+
+{{{
+blastdbcmd -db myBlastDatabase.fa -entry_batch IDs_to_get.txt > IDs_to_get.fa
+}}}
+
+where the format of IDs_to_get.txt (IDs of sequences you want to extract) is simply one ID per line, such as
+
+  
+{{{
+Sequence2
+Sequence3
+Sequence4
+}}}
+
+and the output file is standard fasta.
+
+  * Get all command-line arguments
+
+{{{
+blastn -help
+}}}
+
+  * Note that databases indexed for old-style blastall (using formatdb) work fine with blast+.
+
+=== Filtering BLAST results===
+  * Limiting or filtering hits: do not use max_target_seqs.  Based on [[https://academic.oup.com/bioinformatics/advance-article/doi/10.1093/bioinformatics/bty833/5106166 | Misunderstood parameter of NCBI BLAST impacts the correctness of bioinformatics workflows]], this parameter does not return the top/best hit(s)!  Instead, get all hits and filter downstream as needed.
+