=== BLAST+ Quick Start Guide ===

For more complete information, visit NCBI:
  * [[http://www.ncbi.nlm.nih.gov/books/NBK1763/|BLAST Command Line Applications User Manual]]
  * [[http://www.ncbi.nlm.nih.gov/books/NBK279675/ | BLAST+ Command-line options]]
  * [[http://iona.wi.mit.edu/bio/databases/list.php | Local Blast Databases]]
  * [[http://www.biomedcentral.com/1471-2105/10/421|BLAST+: architecture and applications]] - BMC Bioinformatics 2009, 10:421

**Examples are all for BLASTN but should work similarly for other BLAST+ commands (blastp, blastx, tblastn, and tblastx). **


**Note that on tak, 'blastn' is an alias for 'bsub blastn' (and other BLAST+ commands have corresponding aliases), so don't include 'bsub' as part of your command.**


=== Tasks ===
||'''Task''' || '''Description''' ||
||blastp	|| Traditional BLASTP to compare a protein query to a protein database ||
||blastp-short || BLASTP optimized for queries shorter than 30 residues ||
||blastn || Traditional BLASTN requiring an exact match of 11 ||
||blastn-short || BLASTN program optimized for sequences shorter than 50 bases ||
||megablast || Traditional megablast used to find very similar (e.g., intraspecies or closely related species) sequences ||
||dc-megablast ||	Discontiguous megablast used to find more distant (e.g., interspecies) sequences ||


=== Index or Make BLAST database ===
* Index a file of fasta sequences to create a custom blastn database, such as

{{{
>Sequence1
CTGTGACTTGAATGCAAATATCACCAAGAAGTTTGTGAGA
>Sequence2
TGGGAGGGGCTTGGCGGGGAGTCCGTTGTTGAAGGATGGT
...
}}}
     


{{{
makeblastdb -dbtype nucl -parse_seqids -in myBlastDatabase.fa
}}}


Note that '–parse_seqids' is needed to be able to later extract sequences by their IDs, but using it drastically slows down indexing.  For '-dbtype', choose '''nucl''' or '''prot'''.

  * Specify a title for the database as well as an output file name

{{{
makeblastdb -in mature_mirna -title "micrornas $today" -parse_seqids -dbtype nucl -out mature_mirna
}}}

In the blast version 2.8 and later, you could also search for target sequences belong to certain species. The database should be in version 5 format. To create the databases, you need to specify '-parse_seqids -blastdb_version 5' and assign sequences to taxonomy ID with -taxid or -taxid_map, such as -taxid 9606 to assign all sequences to human. With '-taxid_map', you could assign a species to each sequence.  It requires a text file with format: <SequenceId> <TaxonomyId><newline>


=== Run BLAST command ===

  * Run a basic (but sensitive) blastn search.  The default blastn command runs megablastn with a default word size of 28, whereas '-task blastn' uses a default word size of 11.

{{{


blastn -task blastn -query Query_seqs.fa -db myBlastDatabase.fa -evalue 0.05 -out Query_seqs.blastn.txt
}}}

  * Run the blastn program optimized for sequences shorter than 50 bases (default word size of 7) 

{{{
blastn -task blastn-short -query oligos.fa -db mature_mirna -out Query_seqs.blastn-short.txt
}}}

  * Restrict search of database to include only the specified taxonomy IDs
{{{
# limit to human targets:
blastn -query oligos.fa -db nt -taxids 9606 -out Query_seqs_to_human.txt

# blast to all species under plant:
blastn -query oligos.fa -db nt -taxidlist plant_speciesTaxids.txt -out Query_seqs_to_plants.txt
# where plant_speciesTaxids.txt includes species taxonomy ids for all plants, which can be created with 
get_species_taxids.sh  -t 3193 > plant_speciesTaxids.txt
# where 3193 refers to plant
}}}

  * Extract all sequence(s) from a blast database (in case you've deleted the original fasta file)

{{{
blastdbcmd -db myBlastDatabase.fa -entry all > myBlastDatabase.fa
}}}

Note that the output format for custom databases may be not quite fasta:

 
{{{
>lcl|Sequence0CTGTGACTTGAATGCAAATATCACCAAGAAGTTTGTGAGA
>lcl|Sequence1TGGGAGGGGCTTGGCGGGGAGTCCGTTGTTGAAGGATGGT
...
}}}


  * Extract one desired sequence ID from a blast database

{{{
blastdbcmd -db myBlastDatabase.fa -entry Sequence2 > Sequence2.fa
}}}

  * Extract a list of desired sequence IDs from a blast database

{{{
blastdbcmd -db myBlastDatabase.fa -entry_batch IDs_to_get.txt > IDs_to_get.fa
}}}

where the format of IDs_to_get.txt (IDs of sequences you want to extract) is simply one ID per line, such as

  
{{{
Sequence2
Sequence3
Sequence4
}}}

and the output file is standard fasta.

  * Get all command-line arguments

{{{
blastn -help
}}}

  * Note that databases indexed for old-style blastall (using formatdb) work fine with blast+.

=== Using more restrictive BLAST options ===

Limiting or filtering hits can be done by the following options, which are all a bit different:

  * -max_target_seqs => Maximum number of aligned sequences to keep (value of 5 or more is recommended; incompatible with num_descriptions, num_alignments)
  * -num_descriptions => Number of database sequences to show one-line descriptions for
  * -num_alignments => Number of database sequences to show alignments for

Requiring higher-confident hits than the defaults can also be useful

  * -evalue => Expectation value (E) threshold for saving hits (default = 10); can be reduced to 0.1 or even 1e-10 (depending on the reason for doing the BLAST search)