Changes between Version 14 and Version 15 of SOPs/qc_shortReads

Timestamp:

01/29/14 15:19:14 (11 years ago)

Author:

byuan

Comment:

--

SOPs/qc_shortReads

@@ -178 +178 @@
          * repetitive segments in the "over represented sequences" section.
          * "Per base sequence content" for any patterns at the beginning of your reads
-    * See [[http://hannonlab.cshl.edu/fastx_toolkit/commandline.html#fastx_clipper_usage|fastx_clipper usage]] (or ''fastx_clipper -h'') for more arguments
+
+
+  * [[http://code.google.com/p/cutadapt/|cutadapt]] is a good tool that is designed to find and remove adapters:
+    * more options than fastx_clipper, such as specifically trimming 5' or 3' adapters and specifying error rate (allowed mismatches)
+    * much more conservative than fastx_clipper.
+    * [wiki:SOPs/cutadapt sample usage]
+    * sample command:
+
+{{{
+bsub cutadapt -a GATCGGAAGAGCTCGTATGCCGTCTT –o Nanog_noAdapter.fastq Nanog.fastq
+
+In the above command:
+   -a: Sequence of an adapter that was ligated to the 3' end.
+   -o:  output file name
+}}}
+
+  * See [[http://hannonlab.cshl.edu/fastx_toolkit/commandline.html#fastx_clipper_usage|fastx_clipper usage]] (or ''fastx_clipper -h'') for more arguments
   * sample command:
 
@@ -198 +214 @@
     * Add the argument -Q 33, such as
     * fastx_clipper -a CTGTAGGCACCATCAAT -Q 33 -i s2_sequence.txt -v -l 22 -o s2_sequence_noLinker.txt
-
-  * [[http://code.google.com/p/cutadapt/|cutadapt]] is another tool that is designed to find and remove adapters:
-    * more options than fastx_clipper, such as specifically trimming 5' or 3' adapters and specifying error rate (allowed mismatches)
-    * [wiki:SOPs/cutadapt sample usage]
 
 == Trim reads to a specified length ==