Changes between Version 41 and Version 42 of SOPs/qc_shortReads

Timestamp:

09/26/17 08:48:11 (8 years ago)

Author:

gbell

Comment:

--

SOPs/qc_shortReads

@@ -210 +210 @@
     * more options than fastx_clipper, such as specifically trimming 5' or 3' adapters and specifying error rate (allowed mismatches)
     * much more conservative than fastx_clipper.
-    * [wiki:SOPs/cutadapt sample usage]
+    * In paired-end mode, if a read is removed from one file, its pair will be removed from the other file
+    * [https://cutadapt.readthedocs.io/en/stable/guide.html|User guide]
     * a vs b options from [[http://journal.embnet.org/index.php/embnetjournal/article/view/200|EMBnet.journal]]
        [[Image(cutadapt.2.jpeg,500px)]]
-       * sample command:
+
+       * sample commands:
     {{{
-    bsub cutadapt -a GATCGGAAGAGCTCGTATGCCGTCTT -o Nanog_noAdapter.fastq Nanog.fastq
+    # single-end reads
+    bsub cutadapt -a GATCGGAAGAGCTCGTATGCCGTCTT -o Reads_noAdapter.fastq Reads.fastq
 
     In the above command:
        -a: Sequence of an adapter that was ligated to the 3' end.
        -o:  output file name
+
+    # paired-end reads
+    bsub cutadapt -a GATCGGAAGAGCTCGTATGCCGTCTT -o Reads_trimmed.1.fq -p Reads_trimmed.2.fq Reads.1.fq Reads.2.fq
     }}}
 
-
-  * '''Method 2''': [[http://hannonlab.cshl.edu/fastx_toolkit/commandline.html#fastx_clipper_usage|fastx_clipper]]
+  * '''Method 2''': [[https://www.bioinformatics.babraham.ac.uk/projects/trim_galore/|Trim Galore!]] combines cutadapt, FastQC, and the ability to guess what your adapters are 
+     * Sample command
+{{{
+# Usage (single-end reads): trim_galore [options] <filename(s)>
+trim_galore --phred64 --fastqc  -o my_trimmed_reads raw_reads/My_reads.fq.gz
+# Usage (paired-end reads; discard pair if at least one read is too short):
+trim_galore --paired --phred64 --fastqc  -o my_trimmed_reads raw_reads/My_reads_1.fq.gz raw_reads/My_reads_2.fq.gz
+# Get all options
+trim_galore --help
+
+--phred64 ==> Use Illumina 1.5 encoding quality scores
+--fastqc ==> Run FastQC after trimming
+-o ==> Print output files in this directory instead of the current directory
+}}}
+
+  * '''Method 3''': [[http://hannonlab.cshl.edu/fastx_toolkit/commandline.html#fastx_clipper_usage|fastx_clipper]]
     * Sample command:
 {{{
@@ -243 +263 @@
         * fastx_clipper -a CTGTAGGCACCATCAAT -Q 33 -i s2_sequence.txt -v -l 22 -o s2_sequence_noLinker.txt
 
-  * '''Method 3''': [[https://www.bioinformatics.babraham.ac.uk/projects/trim_galore/|Trim Galore!]] combines cutadapt, FastQC, and the ability to guess what your adapters are 
-     * Sample command
-{{{
-# Usage : trim_galore [options] <filename(s)>
-trim_galore --phred64 --fastqc  -o my_trimmed_reads raw_reads/My_reads.fq.gz
-# Get all options
-trim_galore --help
-
---phred64 ==> Use Illumina 1.5 encoding quality scores
---fastqc ==> Run FastQC after trimming
--o ==> Print output files in this directory instead of the current directory
-}}}
+
 
 == Trim reads to a specified length ==