Changes between Version 61 and Version 62 of SOPs/qc_shortReads
- Timestamp:
- 07/29/24 10:14:16 (2 years ago)
Legend:
- Unmodified
- Added
- Removed
- Modified
-
SOPs/qc_shortReads
v61 v62 98 98 99 99 {{{ 100 bsub"/nfs/BaRC_Public/BaRC_code/Perl/cmpfastq/cmpfastq.pl s_8_1_sequence.txt s_8_2_sequence.txt" # fastq inputs100 sbatch -p 20 "/nfs/BaRC_Public/BaRC_code/Perl/cmpfastq/cmpfastq.pl s_8_1_sequence.txt s_8_2_sequence.txt" # fastq inputs 101 101 }}} 102 102 … … 189 189 190 190 {{{ 191 bsub"fastq_quality_trimmer -v -t 20 -l 25 -i input.fastq -o output.fastq" # fastq input and output192 bsub"gunzip -c input.fastq.gz | fastq_quality_trimmer -v -t 20 -l 25 -z -o output.fastq.gz" # fastq.gz input and output191 sbatch -p 20 "fastq_quality_trimmer -v -t 20 -l 25 -i input.fastq -o output.fastq" # fastq input and output 192 sbatch -p 20 "gunzip -c input.fastq.gz | fastq_quality_trimmer -v -t 20 -l 25 -z -o output.fastq.gz" # fastq.gz input and output 193 193 194 194 [-t N] = Quality threshold - nucleotides with lower … … 231 231 {{{ 232 232 # single-end reads 233 bsubcutadapt -a GATCGGAAGAGCTCGTATGCCGTCTT -o Reads_noAdapter.fastq Reads.fastq233 sbatch -p 20 cutadapt -a GATCGGAAGAGCTCGTATGCCGTCTT -o Reads_noAdapter.fastq Reads.fastq 234 234 235 235 In the above command: … … 238 238 239 239 # paired-end reads 240 bsubcutadapt -a GATCGGAAGAGCTCGTATGCCGTCTT -o Reads_trimmed.1.fq -p Reads_trimmed.2.fq Reads.1.fq Reads.2.fq240 sbatch -p 20 cutadapt -a GATCGGAAGAGCTCGTATGCCGTCTT -o Reads_trimmed.1.fq -p Reads_trimmed.2.fq Reads.1.fq Reads.2.fq 241 241 242 242 # use --quality-base=64 option for Phred+64 (Illumina 1.5) … … 270 270 * Sample command: 271 271 {{{ 272 bsub"fastx_clipper -a CTGTAGGCACCATCAAT -i s2_sequence.txt -v -l 22 -o s2_sequence_noLinker.txt" # fastq input and output273 bsub"gunzip -c s2_sequence.txt | fastx_clipper -a CTGTAGGCACCATCAAT -v -l 22 -z -o s2_sequence_noLinker.txt.gz" # fastq.gz input and output272 sbatch -p 20 "fastx_clipper -a CTGTAGGCACCATCAAT -i s2_sequence.txt -v -l 22 -o s2_sequence_noLinker.txt" # fastq input and output 273 sbatch -p 20 "gunzip -c s2_sequence.txt | fastx_clipper -a CTGTAGGCACCATCAAT -v -l 22 -z -o s2_sequence_noLinker.txt.gz" # fastq.gz input and output 274 274 275 275 … … 293 293 * sample command: 294 294 {{{ 295 bsub"fastx_trimmer -f 1 -l 22 -i s7_sequence_clipped.txt -o s7_sequence_clipped_trimmed.txt" # fastq input and output296 bsub"gunzip -c s7_sequence_clipped.txt | fastx_trimmer -f 1 -l 22 -z -o s7_sequence_clipped_trimmed.txt.gz" # fastq.gz input and output295 sbatch -p 20 "fastx_trimmer -f 1 -l 22 -i s7_sequence_clipped.txt -o s7_sequence_clipped_trimmed.txt" # fastq input and output 296 sbatch -p 20 "gunzip -c s7_sequence_clipped.txt | fastx_trimmer -f 1 -l 22 -z -o s7_sequence_clipped_trimmed.txt.gz" # fastq.gz input and output 297 297 298 298 [-i INFILE] = FASTA/Q input file. default is STDIN.
