Changes between Version 61 and Version 62 of SOPs/qc_shortReads

Timestamp:

07/29/24 10:14:16 (5 months ago)

Author:

xinlei.gao

Comment:

--

SOPs/qc_shortReads

@@ -98 +98 @@
 
 {{{
-   bsub "/nfs/BaRC_Public/BaRC_code/Perl/cmpfastq/cmpfastq.pl s_8_1_sequence.txt s_8_2_sequence.txt"  # fastq inputs
+   sbatch -p 20 "/nfs/BaRC_Public/BaRC_code/Perl/cmpfastq/cmpfastq.pl s_8_1_sequence.txt s_8_2_sequence.txt"  # fastq inputs
 }}}
 
@@ -189 +189 @@
 
 {{{
-bsub "fastq_quality_trimmer -v -t 20 -l 25 -i input.fastq -o output.fastq"  # fastq input and output
-bsub "gunzip -c input.fastq.gz | fastq_quality_trimmer -v -t 20 -l 25 -z -o output.fastq.gz"  # fastq.gz input and output
+sbatch -p 20 "fastq_quality_trimmer -v -t 20 -l 25 -i input.fastq -o output.fastq"  # fastq input and output
+sbatch -p 20 "gunzip -c input.fastq.gz | fastq_quality_trimmer -v -t 20 -l 25 -z -o output.fastq.gz"  # fastq.gz input and output
 
    [-t N]       = Quality threshold - nucleotides with lower
@@ -231 +231 @@
     {{{
     # single-end reads
-    bsub cutadapt -a GATCGGAAGAGCTCGTATGCCGTCTT -o Reads_noAdapter.fastq Reads.fastq
+    sbatch -p 20 cutadapt -a GATCGGAAGAGCTCGTATGCCGTCTT -o Reads_noAdapter.fastq Reads.fastq
 
     In the above command:
@@ -238 +238 @@
 
     # paired-end reads
-    bsub cutadapt -a GATCGGAAGAGCTCGTATGCCGTCTT -o Reads_trimmed.1.fq -p Reads_trimmed.2.fq Reads.1.fq Reads.2.fq
+    sbatch -p 20 cutadapt -a GATCGGAAGAGCTCGTATGCCGTCTT -o Reads_trimmed.1.fq -p Reads_trimmed.2.fq Reads.1.fq Reads.2.fq
 
     # use --quality-base=64 option for Phred+64 (Illumina 1.5)
@@ -270 +270 @@
     * Sample command:
 {{{
-bsub "fastx_clipper -a CTGTAGGCACCATCAAT -i s2_sequence.txt -v -l 22 -o s2_sequence_noLinker.txt"  # fastq input and output
-bsub "gunzip -c s2_sequence.txt | fastx_clipper -a CTGTAGGCACCATCAAT -v -l 22 -z -o s2_sequence_noLinker.txt.gz"  # fastq.gz input and output
+sbatch -p 20 "fastx_clipper -a CTGTAGGCACCATCAAT -i s2_sequence.txt -v -l 22 -o s2_sequence_noLinker.txt"  # fastq input and output
+sbatch -p 20 "gunzip -c s2_sequence.txt | fastx_clipper -a CTGTAGGCACCATCAAT -v -l 22 -z -o s2_sequence_noLinker.txt.gz"  # fastq.gz input and output
 
 
@@ -293 +293 @@
    * sample command: 
 {{{
-bsub "fastx_trimmer -f 1 -l 22  -i s7_sequence_clipped.txt -o s7_sequence_clipped_trimmed.txt"  # fastq input and output
-bsub "gunzip -c s7_sequence_clipped.txt | fastx_trimmer -f 1 -l 22 -z -o s7_sequence_clipped_trimmed.txt.gz"  # fastq.gz input and output
+sbatch -p 20 "fastx_trimmer -f 1 -l 22  -i s7_sequence_clipped.txt -o s7_sequence_clipped_trimmed.txt"  # fastq input and output
+sbatch -p 20 "gunzip -c s7_sequence_clipped.txt | fastx_trimmer -f 1 -l 22 -z -o s7_sequence_clipped_trimmed.txt.gz"  # fastq.gz input and output
       
 [-i INFILE]  = FASTA/Q input file. default is STDIN.